Journal: Cell Reports

Article Title: The TGFB2-AS1 lncRNA Regulates TGF-β Signaling by Modulating Corepressor Activity

doi: 10.1016/j.celrep.2019.08.028

Figure Lengend Snippet: Regulation of TGFB2-AS1 Expression by TGF-β Signaling (A) Quantitative real-time PCR to determine TGFB2-AS1 expression in HaCaT cells treated or not with the TGF-β receptor I inhibitor GW6604, with or without TGF-β stimulation for 3 h. (B and C) Quantitative real-time PCR to determine TGFB2-AS1 expression in HaCaT cells transiently transfected with siRNA targeting SMAD4 (B) or SMAD3 (C), with or without TGF-β stimulation for 3 h. (D) Quantitative real-time PCR to determine TGFB2-AS1 expression in HaCaT cells treated with MEK (PD184352), p38 (SB203580), or JNK (SP600125) inhibitors (i), with or without TGF-β stimulation for 24 h. Error bars represent SD from three different experiments. (E) Quantitative real-time PCR for TGFB2-AS1 expression in HaCaT cells transiently transfected with the pcDNA3-TGFB2-AS1 vector. (F) RNA FISH for TGFB2-AS1 in HaCaT cells transiently transfected with the pcDNA3-TGFB2-AS1 vector. Arrows point to individual endogenous TGFB2-AS1 RNA puncta. A magnification bar is also shown. Two representative images (samples) out of three independent experiments are shown. (G) Reporter CAGA 12 -luciferase assay in HepG2 cells transiently transfected with pcDNA3-TGFB2-AS1 and stimulated with TGF-β1 for 24 h. (H) TGF-β-responsive CAGA 12 -luciferase reporter assay in HaCaT cells stably overexpressing TGFB2-AS1 and treated with TGF-β1 for 24 h. (I) TGF-β-responsive CAGA 12 -luciferase reporter assay in HaCaT cells stably overexpressing TGFB2-AS1 , transiently transfected with siTGFB2-AS1 , and treated with TGF-β1 for 24 h. In (G)–(I), error bars represent SD from three different experiments ( ∗ p < 0.05).

Article Snippet: HepG2 human hepatoblastoma , ATCC , ATCC Cat# HB-8065, RRID:CVCL_0027.

Techniques: Expressing, Real-time Polymerase Chain Reaction, Transfection, Plasmid Preparation, Luciferase, Reporter Assay, Stable Transfection

Journal: Cell Reports

Article Title: The TGFB2-AS1 lncRNA Regulates TGF-β Signaling by Modulating Corepressor Activity

doi: 10.1016/j.celrep.2019.08.028

Figure Lengend Snippet:

Article Snippet: HepG2 human hepatoblastoma , ATCC , ATCC Cat# HB-8065, RRID:CVCL_0027.

Techniques: Western Blot, Virus, Control, shRNA, Recombinant, Modification, Protease Inhibitor, Luciferase, Gene Expression, Sequencing, cDNA Synthesis, Immunoprecipitation, Fractionation, Library Amplification, Labeling, RNA Sequencing, Microarray, Mass Spectrometry, Mutagenesis, Software, Microscopy, Imaging, Spectrophotometry

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: Overview of Participating Teams, Utilized Platforms, Number and Names of Genes or Gene Combinations Used, the Origin of Calibration Samples, and Further Details

Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

Techniques: Generated

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

Techniques: Reverse Transcription, Polymerase Chain Reaction, Microarray, Isolation, Red Blood Cell Lysis, Control, Concentration Assay, Sequencing, cDNA Synthesis, Labeling, SYBR Green Assay, Multiplex Assay, TaqMan Assay, Real-time Polymerase Chain Reaction, Software, Extraction

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: The Table Depicts Team Contributions (from Left to Right) Regarding Employed Genes, Reported Dose Estimates per Reference Sample 1–3, Differences among Reported and Reference Dose-Values as well as the Summed Absolute Difference over all Reference Samples (SAD), a Correct (Yes) or Incorrect (No) Order of Dose Estimates (from Lowest to Highest) Corresponding to Three Dose Categories [Unexposed, Low (1.2 Gy) and Highly Exposed (3.5 Gy)], the Use of FDXR Gene Expression Changes for dose estimation, as well as the Report Time

Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

Techniques: Gene Expression

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: Overview of Participating Teams, Utilized Platforms, Number and Names of Genes or Gene Combinations Used, the Origin of Calibration Samples, and Further Details

Article Snippet: TaqMan assays SYBR Green assay , FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) , BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) , CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG , GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC. , TaqMan ® assay: DDB2 (Hs00172068_ml), FDXR (HS01031617_ml), ITFG1: Hs01061271_ml SYBR Green assay: CDKN1A F:CCT CAT CCC GTG TTC TCC TTT CDKN1A R: GTA CCA CCC AGC GGA CAA GT GAPDH F: CGA CCA CTT TGT CAA GCT CA GAPDH R: AGG GGT CTA CAT GGC AAC TG HPRT F: TGA CAC TGG CAA AAC AAT GCA HPRT R: GGT CCT TTT CAC CAG CAA GCT , FDXR (HS01031617_ml) , DDB2 (Hs00172068_ml), FDXR (HS01031617_ml) , RNA amount used for cDNA synthesis , 0.2 μg; 1.65 μg per array.

Techniques: Generated

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

Article Snippet: TaqMan assays SYBR Green assay , FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) , BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) , CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG , GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC. , TaqMan ® assay: DDB2 (Hs00172068_ml), FDXR (HS01031617_ml), ITFG1: Hs01061271_ml SYBR Green assay: CDKN1A F:CCT CAT CCC GTG TTC TCC TTT CDKN1A R: GTA CCA CCC AGC GGA CAA GT GAPDH F: CGA CCA CTT TGT CAA GCT CA GAPDH R: AGG GGT CTA CAT GGC AAC TG HPRT F: TGA CAC TGG CAA AAC AAT GCA HPRT R: GGT CCT TTT CAC CAG CAA GCT , FDXR (HS01031617_ml) , DDB2 (Hs00172068_ml), FDXR (HS01031617_ml) , RNA amount used for cDNA synthesis , 0.2 μg; 1.65 μg per array.

Techniques: Reverse Transcription, Polymerase Chain Reaction, Microarray, Isolation, Red Blood Cell Lysis, Control, Concentration Assay, Sequencing, cDNA Synthesis, Labeling, SYBR Green Assay, Multiplex Assay, TaqMan Assay, Real-time Polymerase Chain Reaction, Software, Extraction

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: The Table Depicts Team Contributions (from Left to Right) Regarding Employed Genes, Reported Dose Estimates per Reference Sample 1–3, Differences among Reported and Reference Dose-Values as well as the Summed Absolute Difference over all Reference Samples (SAD), a Correct (Yes) or Incorrect (No) Order of Dose Estimates (from Lowest to Highest) Corresponding to Three Dose Categories [Unexposed, Low (1.2 Gy) and Highly Exposed (3.5 Gy)], the Use of FDXR Gene Expression Changes for dose estimation, as well as the Report Time

Article Snippet: TaqMan assays SYBR Green assay , FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) , BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) , CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG , GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC. , TaqMan ® assay: DDB2 (Hs00172068_ml), FDXR (HS01031617_ml), ITFG1: Hs01061271_ml SYBR Green assay: CDKN1A F:CCT CAT CCC GTG TTC TCC TTT CDKN1A R: GTA CCA CCC AGC GGA CAA GT GAPDH F: CGA CCA CTT TGT CAA GCT CA GAPDH R: AGG GGT CTA CAT GGC AAC TG HPRT F: TGA CAC TGG CAA AAC AAT GCA HPRT R: GGT CCT TTT CAC CAG CAA GCT , FDXR (HS01031617_ml) , DDB2 (Hs00172068_ml), FDXR (HS01031617_ml) , RNA amount used for cDNA synthesis , 0.2 μg; 1.65 μg per array.

Techniques: Gene Expression

Journal: Cancer cell

Article Title: Oncogenic KRAS regulates amino acid homeostasis and asparagine biosynthesis via ATF4 and alters sensitivity to L-asparaginase

doi: 10.1016/j.ccell.2017.12.003

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Human: NCI-H1792 (Male) , ATCC , CRL-5895.

Techniques: Virus, Plasmid Preparation, Recombinant, Labeling, cDNA Synthesis, SYBR Green Assay, Microarray, Expressing, Gene Expression, Mutagenesis, Software

Journal: Cancer cell

Article Title: Oncogenic KRAS regulates amino acid homeostasis and asparagine biosynthesis via ATF4 and alters sensitivity to L-asparaginase

doi: 10.1016/j.ccell.2017.12.003

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: AZD6244, MEK inhibitor , Selleck Chemicals , Cat# S1008; CAS: 606143-52-6.

Techniques: Virus, Plasmid Preparation, Recombinant, Labeling, cDNA Synthesis, SYBR Green Assay, Microarray, Expressing, Gene Expression, Mutagenesis, Software

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: Intracellular P. gingivalis ( P. g ) Significantly Induces and Co-Localizes with LC3C, an Isomer of LC3, and this Specific Event is Highly Dependent on HSp27 for Successful Autophagic Survival. Human primary GECs were treated with HSp27 siRNA (100nM) for 48 h. P. g was added at MOI 100 to GECs, which were incubated for 6 or 24 h. ( A ) GECs were targeted for P. g (rabbit anti- P. g ; goat anti-rabbit Ultra Small Gold Antibody) and labeled P. g was found to be readily ensconced within double-membraned autophagosomes in GECs. Following HSp27 depletion, P. g appeared to readily start to degrade. Representative transmission electron microscopy images of P. g -infected GECs were also taken at 80 kV and 100000x magnification. Scale bar is 800 nm. ( B ) 6 h and 24h P. g-infected GECs were also stained for P. g (rabbit anti-P . g ; Alexa 488; green) and LC3C (mouse anti-LC3C; Alexa 568; red) to examine whether LC3C characterizes P. g -specific autophagosomes. These cells were then imaged via confocal microscopy (Leica DM6 CS Stellaris 5 Confocal/Multiphoton System) at 63x. The range of z-stacks was kept consistent and representative images were selected from the mid-ranged sections. ( Bi ) The Imaris software was utilized to obtain a xoomed 63x Orthogonal Image of 24 h P. g infection and found heightened co-localization between P. g and LC3C. LC3C was found to readily colocalize with P. g, having an average Pearson correlation coefficient of 0.96 via the Imaris post-processing software. ( C ) Lysates of infected and HSp27-depleted GECs were also analyzed via western blotting. Non-target controls were performed and not shown. (Ci) Quantitative ImageJ analysis was performed for the western blot results. Data is represented as Mean±SD, where n=3 and p<0.05 was considered as statistically significant via Student two-tailed T-test. **p<.005.

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Incubation, Labeling, Transmission Assay, Electron Microscopy, Infection, Staining, Confocal Microscopy, Software, Western Blot, Two Tailed Test

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: The Autophagic Lifestyle of P. gingivalis (P. g) is Highly Characterized by Only the LC3C Isoform of LC3, Which is not Increased During Starvation-Induced Autophagy in GECs. (A ) The LC3 A/B lipidation results of the same assay provided in . (B ) GECs were separately treated with LC3B siRNA (100nM) for 48h. P. g was added at MOI 100 to GECs for 6 h. Intracellular P. g survival after LC3B siRNA depletion was determined using a standard antibiotic protection assay using P. g- specific 16S rRNA primers. ( C ) GECs were subjected to starvation conditions in HBSS for 24 h. GECs were then collected and fixed so that immunofluorescence could be performed. GECs were stained for LC3C (rabbit anti-LC3C;Alexa 568; red). GECs were then imaged via confocal microscopy (Super Resolution Zeiss Airyscan LSM 880) at 63x. Western blotting (Not Shown) was utilized to confirm the lack of induction of LC3C I and LC3C II. Data is represented as Mean±SD; n=3; p<0.05 is considered statistically significant (Student two-tailed T-test).

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Immunofluorescence, Staining, Confocal Microscopy, Western Blot, Two Tailed Test

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: HSp27 Presence Permits the Prolonged Existence of LC3C-characterized, P. gingivalis Specific Autophagosomes by Hampering Canonical Autolysosomal Fusion in Primary GECs. ( A ) Human primary GECs were transfected with mCherry-eGFP-LC3C for 48 h. Select GECs were also treated with 1 uM of the autophagolysosomal fusion inhibitor Bafilomycin A1, 1 uM Pepstatin A, or 5 mM 3-MA. Others were treated with Hsp27 siRNA (100nM) for 24 h. P. g was added at MOI 100 to GECs, which were incubated for 24 h. ( A ) GECs were then stained for P. g (mouse anti- P.g; Alexa 405; blue) and were mounted. GECs were then imaged via confocal microscopy (Leica DM6 CS Stellaris 5 Confocal/Multiphoton System) at 63x. ( Ai ) Imaris was used to obtain a zoomed 63x orthogonal image of 24 h P. g infection and measure the high co-localization levels between P. g and the LC3C Reporter System. P. g localized readily to the LC3C construct, with a Pearson correlation coefficient of 0.82. (B) Separately, GECs were additionally stained for P. g (rabbit anti-P . gingivalis ; Alexa 488; green) and LAMP-1 (mouse anti-LAMP-1; Alexa 568; red) and were imaged. The range of all z-stacks was kept consistent and representative images were selected from the mid-ranged sections. Scale bar is 40 µm for 63x Magnification. ( Bi ) Imaris was used to obtain a zoomed 63x orthogonal image of 24 h P. g infection and measure the co-localization levels between P. g and LAMP-1 in infected and treated GECs. While P. g infected GECs did not exhibit high co-localization with LAMP-1 (Pearson correlation coefficient of .25), their HSp27-depleted counterparts did, with an average Pearson correlation coefficient of 0.83. The Scale bar is 20 µm for 63x Magnification. ( C ) Finally, GECs treated with autophagic inhibitors were targeted for P. g (rabbit anti- P. g ; goat anti-rabbit Ultra Small Gold Antibody) and labeled P. g was found to be readily ensconced within double-membraned autophagosomes in GECs. Representative transmission electron microscopy images of P. g -infected GECs were taken at 80 kV and 30000x or 100000x magnification. Following HSp27 depletion, P. g appeared to readily start to degrade, however treatment with late-stage autophagic inhibitors Bafilomycin A1 or Pepstatin A appeared to rescue P. g from degradation. Representative transmission electron microscopy images of P. g -infected GECs were taken at 80 kV and 30000x or 100000x magnification. Scale bar is 800 nm.

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Transfection, Incubation, Staining, Confocal Microscopy, Infection, Construct, Labeling, Transmission Assay, Electron Microscopy

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: Depletion of LC3C via siRNA Collapses P. gingivalis (P. g) -Induced Non-Canonical Autophagosomal Integrity. Human primary GECs were treated with LC3C siRNA (100nM) for 48h. P. g was added at MOI 100 to GECs for 6, 12, or 24 h. ( A ) Intracellular P. g survival after LC3C siRNA depletion was determined using a standard antibiotic protection assay. In brief, any extracellular bacteria were killed via 1h gentamicin (300 μg/mL) and metronidazole (200 μg/mL) treatment. cDNAs were synthesized for qPCR using P. g -specific 16S rRNA primers to quantify intracellular levels of live P. g . Data is represented as Mean±SD, where n=3 and p<0.05 was considered as statistically significant via Student two-tailed T-test. *p<.05 **p<.005. ( B ) P. g -specific autophagosomes were also selectively isolated. Autophagosomes were stained for P. g (rabbit anti- P. g ; Alexa 488; green) and reduced GSH (ThiolTracker Violet; blue). Confocal images of P. g -specific autophagosomes at 6 h post-infection (63x) were taken utilizing the Super Resolution Zeiss Airyscan LSM 880.

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Bacteria, Synthesized, Two Tailed Test, Isolation, Staining, Infection

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: P. gingivalis (P. g) Causes the Nucleation of Hsp27-Mediated LC3C Accumulation and Lipidation; this Specific Assembly is Highly Dependent on Host Cells’ Redox Potential Determined by eATP Treatments. Human primary GECs were treated with HSp27 siRNA (100nM) for 48 h. P. g was added at MOI 100 to GECs, which were incubated 6 and 24 h. Non-Depleted and HSp27-depleted GECs also were treated with the physiologically-relevant oxidative stress inducer eATP (3mM) treatment for 30 min prior to infection, and were analyzed by western blot.

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Incubation, Infection, Western Blot

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: P. gingivalis ( P. g ) Induces and Prolongs the Autophagosomal LC3C/Beclin 1/ATG14 Nucleation Complex in a Manner Dependent upon HSp27 and the Reduced Redox State of Infected GECs as Determined by Isolated P. g- Specific Autophagosomes. GECs were treated with HSP27siRNA (100nM) for 48 h. Select GECs were also treated with N-acetyl Cysteine (NAC)(50 uM) for 1 h and/or eATP (3mM) for 30 min. P. g was added at MOI 100 to GECs, which were incubated 6 and 12 h. Autophagosomes were then isolated and prepared for analysis. ( A ) The glutathione (GSH) levels of primary GECs were also measured using chemiluminescence detection. ( B) Isolated autophagosomes were analyzed via western blot. ( Bi ), ( Bii ), ( Biii ) Quantitative ImageJ analysis was performed of each of the western blot results. Data is represented as Mean±SD, where n=3 for results. p<0.05 was considered as statistically significant via Student two-tailed T-test. *p<.05 **p<.005

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Infection, Isolation, Incubation, Western Blot, Two Tailed Test

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: HSp27 and LC3C Recruit Beclin 1 and ATG14 to Form a Temporal Pro-bacterial Autophagic Complex, which Can Be Disrupted by Increased Oxidative Stress. Human Primary GECs were treated with HSp27siRNA (100nM) for 48 h. Select GECs were also treated with N-acetyl Cysteine (NAC) (50 uM) for 1 h and/or eATP (3mM) for 30 min. P. gingivalis (P. g) was added at MOI 100 to GECs, which were incubated 6 and 12 h. GECs were then lysed and the extracts were incubated in rabbit anti-LC3C antibody over-night. Samples underwent co-immunoprecipitation. ( A ) The eluted protein complexes were then analyzed by western blot. ( Ai ), ( Aii ), and ( Aiii ) Quantitative ImageJ analysis of western blot results was performed for each of the proteins in question. ( B ) GECs also underwent staining for HSp27 (goat anti-HSp27; Alexa 405; blue), LC3C (rabbit anti-LC3C; Alexa 488; green), and Beclin 1 (sheep anti-Beclin 1; Alexa 568; red), and ATG14 (mouse anti-ATG14; Alexa 647; magenta) to examine the formation of the pro-bacterial autophagic initiation complex. GECs were then imaged via Leica DM6 CS Stellaris 5 Confocal/Multiphoton System at 63x. The Imaris software was used to obtain zoomed orthogonal views of ( Bi ) An infected GECs and ( Bii ) a theoretical autophagosome with HSp27, LC3C, ATG14, and Beclin 1 highly co-localized about it. The scale bar is 20 µm for all Magnification. All of the markers were found to have a Pearson correlation coefficient greater than .9 with each other via Imaris, denoting their close theorized interactions. Data is represented as Mean±SD, where n=3 and p<0.05 was considered as statistically significant via Student two-tailed T-test. *p<.05 **p<.005

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Incubation, Immunoprecipitation, Western Blot, Staining, Software, Infection, Two Tailed Test

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: HSp27 and LC3C Selectively and Specifically Partner with One Another to Promote P. gingivalis ( P. g )-Induced Autophagy. P. g was added at MOI 100 to Human Primary GECs, which were incubated 6 and 24 h. ( A ) GECs were stained for LC3C (rabbit anti-LC3C; Alexa 488; green) and HSp27 (mouse anti-HSp37; Alexa 568; red) following infection. HSp27 was found to readily and temporally colocalize with LC3C, having a Pearsons correlation coefficient of .85 at 24 h post infection via the Imaris post-processing software. ( B ) To assess if full length HSp27 is truly capable of binding to full-length LC3C, a far western approach was implemented by probing 5 µg of recombinant LC3C with 10 µg of recombinant HSp27 for one hour. Antibody specificity was accounted for via probing the LC3C blot with monoclonal mouse anti-HSp27 antibody (Not shown), which showed no cross-reactivity.

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Incubation, Staining, Infection, Software, Binding Assay, Western Blot, Recombinant

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: HSp27 does not Interact with either LC3A or LC3B isoforms in the way that it interacts with LC3C. A Far Western approach was implemented. rLC3A or rLC3B were loaded and incubated with 10 ug of rHSp27. Interactions for ( Bi ) LC3A and ( Bii ) LC3B were then detected by probing the rLC3A or rLC3B blot with mouse Anti-Hsp27 antibody.

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Western Blot, Incubation

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: Phosphorylated HSp27 (P-HSp27) Preferentially Binds to the C-terminal Tail of LC3C, Inhibiting the Canonical Cleavage of LC3C and Halting the Canonical Maturation of LC3C-Specific Autophagosomes. The structural models of monomeric full-length wild-type ( A ) HSp27 (Uniprot: P04792) and ( B ) LC3C (Uniprot: Q9BXW4) were acquired from the AlphaFold database. Optimized complex configurations between ( C ) LC3C and unmodified HSp27 and ( D ) LC3C and P-HSp27 were then obtained, and the modifications in the theorized interaction sites in their N-terminal regions were highlighted. ( E ) Surface electrostatic potentials of the complexes were additionally mapped, contrasting the varied potentials between the two complexes. ( F ) Finally, the buried surface areas and interaction areas between HSp27 or P-HSp27 and LC3C proteins were also assessed and contact maps were generated.

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Generated

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: P. gingivalis (P. g) Secretes its Ndk Effector Molecule to Activate HSp27 and Induce Temporal HSp27-LC3C Partnering to Inhibit Canonical LC3C Cleavage by ATG4B and Halt Autolyosomal Fusion in GECs. A) Human primary GECs were treated with HSp27 siRNA (100nM) for 48 h or were transfected with 1 µg of the constitutively activated pFLAG-CMV2-HSP27-S78D/S82D construct for 48h. Select GECs were then jointly treated with the late stage autophagy inhibitors 1 µM Pepstatin A, or 1 µM lactostatin for 24h. Wild-type P. g or ΔNDK P. g was then added at MOI 100 to GECs, which were incubated for 24 h. ( A ) GECs also underwent staining for HSp27 (goat anti-HSp27; Alexa 405; blue), LC3C (rabbit anti-LC3C; Alexa 488; green), and Beclin 1 (sheep anti-Beclin 1; Alexa 568; red), and ATG14 (mouse anti-ATG14; Alexa 647; magenta) to examine the formation of the pro-bacterial autophagic initiation complex. GECs were then imaged via Leica DM6 CS Stellaris 5 Confocal/Multiphoton System at 63x. ( B ) A diagram was created detailing how LC3C preferentially partners to P-HSp27 over its non-phosphorylated counterpart, causing a confirmational shift to the C-terminal tail of LC3C. This shift results in the inhibition of the final lipidated LC3C tail cleavage by the ATG4B protease, lending to LC3C not disassociating from the autophagosome and halting fusion with the lysosome. ( C ) A diagram was also created to highlight the temporal relationship between HSp27 and LC3C, where LC3C can initially bind to HSp27 but via the actions of Ndk, it preferentially binds to P-HSp27, resulting in a limiting of mature, cleaved LC3C.

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Transfection, Construct, Incubation, Staining, Inhibition

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: Cross-Sectional Human in Situ Sample and Expression Analyses Support High Levels and Increased Co-localization of P. gingivalis (P. g) , HSp27, and LC3C in Periodontitis-Afflicted Oral Tissues. Publicly available mRNA expression data (GEO accession: GSE79705) was obtained from previously collected and examined periodontitis-afflicted and healthy gingival tissues. This microarray expression data was then analyzed via GEO2R and the relative levels of ( A ) HSp27 and ( B ) LC3C were obtained and compared. Data is represented as Mean±SD, where n=12 and p<0.05 was considered as statistically significant via One-Way Anova. *p<0.05. Representative confocal images of gingival biopsy specimens from healthy individuals and periodontitis-afflicted patients were also taken and examined. DAPI staining was utilized to visualize cellular DNA. ( C ) P. g (mouse anti-P . gingivalis ; Alexa 488; green) and LC3C (rabbit anti-LC3C; Alexa 594; red) were detected via dual staining. ( D ) HSp27 (mouse anti-HSp27; Alexa 488; green) and LC3C detection (rabbit anti-LC3C; Alexa 594; red) were also detected. Images were then captured using super resolution confocal laser scanning microscopy (Leica DM6 CS Stellaris 5 Confocal/Multiphoton System) at 10x and 63x magnification with oil immersion. Zoomed (2x) 3D versions of the 63x magnifications were obtained via the Imaris software. The range of z-stacks was kept consistent. SC: Stratum corneum, SL: Stratum lucidum, SG: Stratum granulosum, SB: Stratum basale, LT: Lamina propria. Scale bars = 200µm for 10x and 20 µm for 63x. Quantification of mean fluorescence intensity provided in Supplement. LC3C and HSp27 both were found to exhibit high levels of co-localization with each other and with P. g, as the Pearson coefficient was calculated to be .93 for LC3C and P. g and .85 for LC3C and HSp27 via the Imaris Software at the most severe state of disease.

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: In Situ, Expressing, Microarray, Staining, Confocal Laser Scanning Microscopy, Software, Fluorescence

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: Quantifications of Cross-Sectional Human Ex-Vivo Samples Support High Levels of P. gingivalis (P. g) , HSp27, and LC3C in Chronically Diseased Oral Tissues (i.e. Periodontitis). Representative confocal images of gingival biopsy specimens from healthy individuals and periodontitis patients were obtained using the Leica DM6 CS Stellaris 5 Confocal/Multiphoton System so that the mean fluorescence intensity of ( A ) HSp27 ( B ) P. g and ( C ) LC3C could be calculated using ImageJ with JACoP Plugin. Data are presented as mean ± SD. Representative images from at least 5 different patients per group were used for quantitative analysis and p<0.05 was considered as statistically significant via Student two-tailed T-test. *p<.05 **p<.005

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Ex Vivo, Fluorescence, Two Tailed Test

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: HSp27 is a Critical Regulator in Pro-bacterial LC3C-Characterized Autophagy, Facilitating the Intracellular Autophagic Survival of P. gingivalis (P. g) and Influencing the Bacterial Symbiosis of the Oral Mucosa. The proposed diagram of the identified mechanisms of P. gingivalis persistence in GECs. ( A ) HSp27 is largely induced and spatially recruited by P. g invasion of the host cells. After the initial periods of cellular infection, the gradually growing secretion of the bacterial Nucleoside-diphosphate-kinase (Ndk) into the cytoplasmic space causes heightened activation of HSp27 (P-HSp27) via direct phosphorylation. P-HSp27 abrogates extracellular ATP (eATP)-induced antimicrobial Reactive-Oxygen-Species (ROS) production via increasing glutathione (GSH) levels. In parallel, P. g -mediated induction of HSp27 promotes the specific recruitment and lipidation of LC3C, an isomer of the LC3 autophagosomal structural molecule, which is strictly dependent upon the large presence and the strong antioxidant activity of HSp27. LC3C and HSp27 partner in a stepwise manner, 1) their coupling drives the formation of Beclin1/ATG14 induction, 2) where the temporally increased phosphorylation of HSp27 by P. g Ndk both strengthens the P-HSP27 and LC3C partnering and shifts the confirmation of the LC3C tail so that LC3C cannot be successfully further cleaved by ATG4. ( B ) P-HSp27 and LC3C become increasingly assembled to the ATG14-Incorperated Nucleation Complex, where they prolong the complex’s formation and result in the accumulation of the complex on forming autophagic membranes. Thus, the strengthened partnering between P-HSp27 and LC3C is the proposed mechanism for inhibiting the autolysosomal fusion of P. g- specific autophagosomes, which is also controlled by the host cell redox homeostasis ( C ) Autophagic P. g does not undergo lysosomal degradation and is instead able to survive, multiply and subsequently intercellularly spread to neighboring cells to propagate. ( D ) Thus, the non-canonical, pro-bacterial autophagic events create a favorable and protected cellular environment for P. g , thereby establishing long-term intracellular bacterial persistence. The chronic colonization of P. g in the epithelia can lead to host-microbial dysbiosis in oral mucosa and systemic disorders.

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Infection, Activation Assay, Phospho-proteomics, Antioxidant Activity Assay

Journal: Cell metabolism

Article Title: Cancer Lipid Metabolism Confers Antiangiogenic Drug Resistance.

doi: 10.1016/j.cmet.2018.05.005

Figure Lengend Snippet: Figure 1. Tumor and Angiogenesis Responses to AAD in Adipose and Non-adipose Tissues (A–H) CRC (A–D) and PDAC (E–H) tumors implanted in subcutaneous (non-adipose) and inguinal WAT were treated with a NIIgG or an anti-VEGF neutralizing antibody (n = 8–10 mice per group). Tumor growth (A–C and E–G) was measured as volumes (A, B, E, and F) and weight (C and G). Percentages of tumor inhibition were calculated (D and H). (I and K) Micrographs of CD31+ microvessels (red) in association with NG2+ pericytes (green in upper panels), leakiness of 70-kDa dextran (green in middle panels), and perfusion of 2000-kDa dextran (green in lower panels) in NIIgG- and anti-VEGF-treated non-adipose and adipose CRC (I) and PDAC (K) cancers. Arrows in upper panels point to NG2+ pericytes in association with tumor vessels. Arrowheads in middle panels indicate leaked dextran signals. Arrows in lower panels indicate perfused tumor vessels. Bar represents 100 mm. (J and L) Quantification of CD31+ tumor vessels (n = 5–10 random fields per group), pericyte-associated vessels (n = 5–10 random fields per group), extravasated 70-kDa dextran signals (n = 4–7 random fields per group), and perfusion of 2,000-kDa dextran (n = 4–7 random fields per group) in CRC (J) and PDAC (L) cancers. *p < 0.05; **p < 0.01; ***p < 0.001. NS, not significant. Data presented as means ± SEM. See also Figures S1 and S2.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Etomoxir Dr. Wolf-BioScience N/A MTT Sigma-Aldrich Cat# M5655 Clodronate liposomes FormuMax Cat# F70101C-N Control Liposomes FormuMax Cat# F70101-N Proteinase inhibitor cocktail Sigma-Aldrich Cat# P8340 Phosphatase inhibitor cocktail Cell Signaling Cat# 5870 Bodipy 558/568 C12 Invitrogen Cat# D-3835 D-luciferin PerkinElmer Cat# 122799 Critical Commercial Assays Cpt1 shRNA lentiviral particles Santa Cruz Biotechnology Cat# sc-40377-V Mycoplasma detection kit Lonza Cat# LT07-318 Pimonidazole Hypoxyprobe Cat# HP6-x cDNA Synthesis Kit Thermo Scientific Cat# K1632 Fast SYBR Green Master Mix Applied Biosystems Cat# 4385612 ATP assay kit Abnova Cat# KA0806 NEFA-HR(2) Assay Reagent 1 Wako Chemicals Cat# 434-91795 NEFA-HR(2) Assay Reagent 2 Wako Chemicals Cat# 434-91995 NEFA-HR(2) Assay Standard Wako Chemicals Cat# 270-77000 2000-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D7137 2000-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D7139 70-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D1822 70-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D1818 GeneJET RNA Purification Kit Thermo Scientific Cat# K0732 Deposited Data Affymetrix microarray data, mouse colorectal cancer grown in non-adipose or white adipose environment This paper GEO:GSE113507 Affymetrix microarray data, mouse colorectal cancer grown in healthy liver or fatty liver with or without antiangiogenic treatment This paper GEO:GSE113508 Experimental Models: Cell Lines MC38 murine colon adenocarcinoma Dr. Rubén Hernández, Center for Applied Medical Research, University of Navarra, Spain N/A Hepa1-6 murine hepatocellular carcinoma ATCC CRL-1830 PancO2 murine pancreatic ductal adenocarcinoma Dr. Maximilian Schnurr, Munich University, Germany N/A Experimental Models: Organisms/Strains Mouse: C57BL/6NJ Jackson Laboratory RRID:IMSR_JAX:005304 Mouse: CB17/Icr-Prkdcscid/IcrCrl Charles River RRID:IMSR_CRL:236 Oligonucleotides qRT-PCR primers.

Techniques: Inhibition

Journal: Cell metabolism

Article Title: Cancer Lipid Metabolism Confers Antiangiogenic Drug Resistance.

doi: 10.1016/j.cmet.2018.05.005

Figure Lengend Snippet: Figure 2. Anti-tumor and Antiangiogenic Responses of CRC and HCC Tumors Implanted in Normal and Steatotic Livers (A and E) Morphological and bioluminescent imaging analyses of tumor signals in healthy and steatotic livers. Arrows indicate surface CRC (A) and HCC (E) tumor nodules in healthy and steatotic livers. Bar represents 1 cm. (B and F) Quantification of liver weight (n = 3–6 mice per group), liver tumor volume (n = 5–7 mice per group), surface visible nodules (n = 5–7 mice per group), and photon counts (n = 6–10 mice per group) in CRC (B) and HCC (F) cancers. (C and G) Micrographs of CD31+ microvessels (red), leakiness of 70-kDa dextran (green in middle panels), and perfusion of 2,000-kDa dextran (green in lower panels) in NIIgG- and anti-VEGF-treated non-steatotic and steatotic CRC (C) and HCC (G) cancers. Arrows in upper panels point to CD31+ tumor vessels. Arrowheads in middle panels indicate extravasated dextran signals. Arrows in lower panels indicate perfused tumor vessels. Bar represents 100 mm. (D and H) Quantification of CD31+ tumor vessels (n = 8 random fields from three to six independent tumor samples per group), extravasated 70-kDa dextran signals (n = 5–6 random fields from three to six independent tumor samples per group), and perfusion of 2,000-kDa dextran (n = 6–8 random fields from three to six independent tumor samples per group) in CRC (D) and HCC (H) cancers. *p < 0.05; **p < 0.01; ***p < 0.001. NS, not significant. Data presented as means ± SEM. See also Figure S3.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Etomoxir Dr. Wolf-BioScience N/A MTT Sigma-Aldrich Cat# M5655 Clodronate liposomes FormuMax Cat# F70101C-N Control Liposomes FormuMax Cat# F70101-N Proteinase inhibitor cocktail Sigma-Aldrich Cat# P8340 Phosphatase inhibitor cocktail Cell Signaling Cat# 5870 Bodipy 558/568 C12 Invitrogen Cat# D-3835 D-luciferin PerkinElmer Cat# 122799 Critical Commercial Assays Cpt1 shRNA lentiviral particles Santa Cruz Biotechnology Cat# sc-40377-V Mycoplasma detection kit Lonza Cat# LT07-318 Pimonidazole Hypoxyprobe Cat# HP6-x cDNA Synthesis Kit Thermo Scientific Cat# K1632 Fast SYBR Green Master Mix Applied Biosystems Cat# 4385612 ATP assay kit Abnova Cat# KA0806 NEFA-HR(2) Assay Reagent 1 Wako Chemicals Cat# 434-91795 NEFA-HR(2) Assay Reagent 2 Wako Chemicals Cat# 434-91995 NEFA-HR(2) Assay Standard Wako Chemicals Cat# 270-77000 2000-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D7137 2000-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D7139 70-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D1822 70-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D1818 GeneJET RNA Purification Kit Thermo Scientific Cat# K0732 Deposited Data Affymetrix microarray data, mouse colorectal cancer grown in non-adipose or white adipose environment This paper GEO:GSE113507 Affymetrix microarray data, mouse colorectal cancer grown in healthy liver or fatty liver with or without antiangiogenic treatment This paper GEO:GSE113508 Experimental Models: Cell Lines MC38 murine colon adenocarcinoma Dr. Rubén Hernández, Center for Applied Medical Research, University of Navarra, Spain N/A Hepa1-6 murine hepatocellular carcinoma ATCC CRL-1830 PancO2 murine pancreatic ductal adenocarcinoma Dr. Maximilian Schnurr, Munich University, Germany N/A Experimental Models: Organisms/Strains Mouse: C57BL/6NJ Jackson Laboratory RRID:IMSR_JAX:005304 Mouse: CB17/Icr-Prkdcscid/IcrCrl Charles River RRID:IMSR_CRL:236 Oligonucleotides qRT-PCR primers.

Techniques: Imaging

Journal: Cell metabolism

Article Title: Cancer Lipid Metabolism Confers Antiangiogenic Drug Resistance.

doi: 10.1016/j.cmet.2018.05.005

Figure Lengend Snippet: Figure 6. Blocking CPT1 Enhances AAD-Mediated Anti-tumor Effects (A and F) shRNA-Cpt1- and control-vehicle-transfected CRC (A) or HCC (F) tumor-bearing mice received NIIgG and anti-VEGF treatment. Upper panels: representative tumors. Arrows point to tumors in each group. Middle panels: extravasation of 70-kDa dextran (green). CD31+ blood vessels (red). Arrowheads indicate leaked dextran signals. Lower panels: perfusion of 2,000-kDa dextran (green). CD31+ blood vessels (red). Arrows indicate perfused tumor vessels. Bar represents 100 mm. (B and G) Immunohistochemical analysis of Ki67+ proliferating cells and activated caspase-3+ apoptotic cells in CRC (B) or HCC (G). Arrows and arrowheads point to proliferating and apoptotic cells, respectively. Bar represents 100 mm. (C and H) Quantification of tumor volumes of various CRC (C) or HCC (H) groups (n = 3–5 animals per group). (D and I) Quantification of CD31+ tumor vessels (n = 9 random fields per group), extravasated 70-kDa dextran signals (n = 9 random fields per group), and perfusion of 2,000-kDa dextran (n = 9 random fields per group) in CRC (D) or HCC (I). (E and J) Quantification of Ki67+ (n = 6 random fields per group) and cleaved caspase-3+ signals (n = 6 random fields per group) in CRC (E) or HCC (J). *p < 0.05; **p < 0.01; ***p < 0.001. NS, not significant. Data presented as means ± SEM. See also Figure S6.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Etomoxir Dr. Wolf-BioScience N/A MTT Sigma-Aldrich Cat# M5655 Clodronate liposomes FormuMax Cat# F70101C-N Control Liposomes FormuMax Cat# F70101-N Proteinase inhibitor cocktail Sigma-Aldrich Cat# P8340 Phosphatase inhibitor cocktail Cell Signaling Cat# 5870 Bodipy 558/568 C12 Invitrogen Cat# D-3835 D-luciferin PerkinElmer Cat# 122799 Critical Commercial Assays Cpt1 shRNA lentiviral particles Santa Cruz Biotechnology Cat# sc-40377-V Mycoplasma detection kit Lonza Cat# LT07-318 Pimonidazole Hypoxyprobe Cat# HP6-x cDNA Synthesis Kit Thermo Scientific Cat# K1632 Fast SYBR Green Master Mix Applied Biosystems Cat# 4385612 ATP assay kit Abnova Cat# KA0806 NEFA-HR(2) Assay Reagent 1 Wako Chemicals Cat# 434-91795 NEFA-HR(2) Assay Reagent 2 Wako Chemicals Cat# 434-91995 NEFA-HR(2) Assay Standard Wako Chemicals Cat# 270-77000 2000-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D7137 2000-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D7139 70-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D1822 70-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D1818 GeneJET RNA Purification Kit Thermo Scientific Cat# K0732 Deposited Data Affymetrix microarray data, mouse colorectal cancer grown in non-adipose or white adipose environment This paper GEO:GSE113507 Affymetrix microarray data, mouse colorectal cancer grown in healthy liver or fatty liver with or without antiangiogenic treatment This paper GEO:GSE113508 Experimental Models: Cell Lines MC38 murine colon adenocarcinoma Dr. Rubén Hernández, Center for Applied Medical Research, University of Navarra, Spain N/A Hepa1-6 murine hepatocellular carcinoma ATCC CRL-1830 PancO2 murine pancreatic ductal adenocarcinoma Dr. Maximilian Schnurr, Munich University, Germany N/A Experimental Models: Organisms/Strains Mouse: C57BL/6NJ Jackson Laboratory RRID:IMSR_JAX:005304 Mouse: CB17/Icr-Prkdcscid/IcrCrl Charles River RRID:IMSR_CRL:236 Oligonucleotides qRT-PCR primers.

Techniques: Blocking Assay, shRNA, Control, Transfection, Immunohistochemical staining

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: P. gingivalis (P. g) Infection Causes a Significant Increase in the Protein HSp27, Accompanied by Large Spatial Accumulation of Hsp27 with the Bacteria in a Temporal Manner in Primary GECs. ( A ) Representative confocal microscopy images of P. g -infected human primary GECs at an MOI 100, at 6 h and 24 h after infection. GECs were then stained for P. g (rabbit anti-P. g; Alexa 488; green) or HSp27 (mouse anti-HSp27; Alexa 568; red). GECs were then imaged via the Leica DM6 CS Stellaris 5 Confocal/Multiphoton System at 63x. ( Ai ) Imaris Software was used to create a zoomed image of infected GECs and was used to calculate the amount of co-localization between P. g and HSp27. HSp27 was found to readily colocalize with P. g , having an average Pearson correlation coefficient of 0.87 via the Imaris software. Scale bar is 30 µm for 63x and Zoomed Magnification. (B ) P. g was added at MOI 100 to GECs, which were incubated 6 or 12h. Cell lysates were then analyzed via western blot. ( Bi ) Quantitative ImageJ analyses of western blot results. Data is represented as Mean±SD, where n=3 and p<0.05 was considered as significant via Two-Tailed Student T-test. *p<0.05.

Article Snippet: Isolated P. gingivalis specific autophagosomes were also fixed in 10% NBF for 1 h, and were stained for 1 h at RT with anti- P. gingivalis ATCC 33277 rabbit antibody (1:1000), followed by incubation in anti-rabbit Alexa Fluor 488 conjugated secondary antibody (Invitrogen, A-11008; 1:1000).

Techniques: Infection, Bacteria, Confocal Microscopy, Staining, Software, Incubation, Western Blot, Two Tailed Test

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: The Integrity of P. gingivalis (P. g) -Specific Autophagosomes is Highly Dependent on HSp27 Presence. Human primary GECs were treated with HSP27siRNA (100nM) for 48 h prior to incubation with P. g ( MOI 100) for 6 h. Autophagosomes were then isolated and analyzed via Confocal Microscopy. ( A ) Schematic autophagosomal isolation method of infected GECs. ( B ) Confocal microscopy images of autophagosomes (ThiolTracker Violet; blue) were obtained via Super Resolution Zeiss Airyscan LSM 880 at 20x. ( C ) Autophagosomes were stained for P. g (rabbit anti- P. g ; Alexa 488; green) and reduced GSH (ThiolTracker Violet; blue). Confocal microscopy images of autophagosomes were obtained via Super Resolution Zeiss Airyscan LSM 880 at 20x. ( Ci ) Quantitative ImageJ analysis of Confocal microscopy results was then performed. Data is represented as Mean±SD, where n=25 and p<0.05 was considered as statistically significant (Student two-tailed T-test). **p<.005

Article Snippet: Isolated P. gingivalis specific autophagosomes were also fixed in 10% NBF for 1 h, and were stained for 1 h at RT with anti- P. gingivalis ATCC 33277 rabbit antibody (1:1000), followed by incubation in anti-rabbit Alexa Fluor 488 conjugated secondary antibody (Invitrogen, A-11008; 1:1000).

Techniques: Incubation, Isolation, Confocal Microscopy, Infection, Staining, Two Tailed Test

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: The Magnetic-Labelling Process Does Not Impact P. gingivalis (P. g) Infection in GECs. P. g was labeled with lipobiotin (5 μM) and were then incubated in MagCellect Streptavidin Ferrofluid. Human Primary GECs were then infected for 24 h. Representative confocal microscopy images of P. g- infected GECs at an MOI 100, were taken at 24 h after infection using via Zeiss LSM 880 (63x). P. g (rabbit anti-P . gingivalis ; Alexa 488; green) was detected in the GECs. Actin (red) was stained utilizing Rho-Phallodin.

Article Snippet: Isolated P. gingivalis specific autophagosomes were also fixed in 10% NBF for 1 h, and were stained for 1 h at RT with anti- P. gingivalis ATCC 33277 rabbit antibody (1:1000), followed by incubation in anti-rabbit Alexa Fluor 488 conjugated secondary antibody (Invitrogen, A-11008; 1:1000).

Techniques: Infection, Labeling, Incubation, Confocal Microscopy, Staining

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: Intracellular P. gingivalis ( P. g ) Significantly Induces and Co-Localizes with LC3C, an Isomer of LC3, and this Specific Event is Highly Dependent on HSp27 for Successful Autophagic Survival. Human primary GECs were treated with HSp27 siRNA (100nM) for 48 h. P. g was added at MOI 100 to GECs, which were incubated for 6 or 24 h. ( A ) GECs were targeted for P. g (rabbit anti- P. g ; goat anti-rabbit Ultra Small Gold Antibody) and labeled P. g was found to be readily ensconced within double-membraned autophagosomes in GECs. Following HSp27 depletion, P. g appeared to readily start to degrade. Representative transmission electron microscopy images of P. g -infected GECs were also taken at 80 kV and 100000x magnification. Scale bar is 800 nm. ( B ) 6 h and 24h P. g-infected GECs were also stained for P. g (rabbit anti-P . g ; Alexa 488; green) and LC3C (mouse anti-LC3C; Alexa 568; red) to examine whether LC3C characterizes P. g -specific autophagosomes. These cells were then imaged via confocal microscopy (Leica DM6 CS Stellaris 5 Confocal/Multiphoton System) at 63x. The range of z-stacks was kept consistent and representative images were selected from the mid-ranged sections. ( Bi ) The Imaris software was utilized to obtain a xoomed 63x Orthogonal Image of 24 h P. g infection and found heightened co-localization between P. g and LC3C. LC3C was found to readily colocalize with P. g, having an average Pearson correlation coefficient of 0.96 via the Imaris post-processing software. ( C ) Lysates of infected and HSp27-depleted GECs were also analyzed via western blotting. Non-target controls were performed and not shown. (Ci) Quantitative ImageJ analysis was performed for the western blot results. Data is represented as Mean±SD, where n=3 and p<0.05 was considered as statistically significant via Student two-tailed T-test. **p<.005.

Article Snippet: Isolated P. gingivalis specific autophagosomes were also fixed in 10% NBF for 1 h, and were stained for 1 h at RT with anti- P. gingivalis ATCC 33277 rabbit antibody (1:1000), followed by incubation in anti-rabbit Alexa Fluor 488 conjugated secondary antibody (Invitrogen, A-11008; 1:1000).

Techniques: Incubation, Labeling, Transmission Assay, Electron Microscopy, Infection, Staining, Confocal Microscopy, Software, Western Blot, Two Tailed Test

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: HSp27 Presence Permits the Prolonged Existence of LC3C-characterized, P. gingivalis Specific Autophagosomes by Hampering Canonical Autolysosomal Fusion in Primary GECs. ( A ) Human primary GECs were transfected with mCherry-eGFP-LC3C for 48 h. Select GECs were also treated with 1 uM of the autophagolysosomal fusion inhibitor Bafilomycin A1, 1 uM Pepstatin A, or 5 mM 3-MA. Others were treated with Hsp27 siRNA (100nM) for 24 h. P. g was added at MOI 100 to GECs, which were incubated for 24 h. ( A ) GECs were then stained for P. g (mouse anti- P.g; Alexa 405; blue) and were mounted. GECs were then imaged via confocal microscopy (Leica DM6 CS Stellaris 5 Confocal/Multiphoton System) at 63x. ( Ai ) Imaris was used to obtain a zoomed 63x orthogonal image of 24 h P. g infection and measure the high co-localization levels between P. g and the LC3C Reporter System. P. g localized readily to the LC3C construct, with a Pearson correlation coefficient of 0.82. (B) Separately, GECs were additionally stained for P. g (rabbit anti-P . gingivalis ; Alexa 488; green) and LAMP-1 (mouse anti-LAMP-1; Alexa 568; red) and were imaged. The range of all z-stacks was kept consistent and representative images were selected from the mid-ranged sections. Scale bar is 40 µm for 63x Magnification. ( Bi ) Imaris was used to obtain a zoomed 63x orthogonal image of 24 h P. g infection and measure the co-localization levels between P. g and LAMP-1 in infected and treated GECs. While P. g infected GECs did not exhibit high co-localization with LAMP-1 (Pearson correlation coefficient of .25), their HSp27-depleted counterparts did, with an average Pearson correlation coefficient of 0.83. The Scale bar is 20 µm for 63x Magnification. ( C ) Finally, GECs treated with autophagic inhibitors were targeted for P. g (rabbit anti- P. g ; goat anti-rabbit Ultra Small Gold Antibody) and labeled P. g was found to be readily ensconced within double-membraned autophagosomes in GECs. Representative transmission electron microscopy images of P. g -infected GECs were taken at 80 kV and 30000x or 100000x magnification. Following HSp27 depletion, P. g appeared to readily start to degrade, however treatment with late-stage autophagic inhibitors Bafilomycin A1 or Pepstatin A appeared to rescue P. g from degradation. Representative transmission electron microscopy images of P. g -infected GECs were taken at 80 kV and 30000x or 100000x magnification. Scale bar is 800 nm.

Article Snippet: Isolated P. gingivalis specific autophagosomes were also fixed in 10% NBF for 1 h, and were stained for 1 h at RT with anti- P. gingivalis ATCC 33277 rabbit antibody (1:1000), followed by incubation in anti-rabbit Alexa Fluor 488 conjugated secondary antibody (Invitrogen, A-11008; 1:1000).

Techniques: Transfection, Incubation, Staining, Confocal Microscopy, Infection, Construct, Labeling, Transmission Assay, Electron Microscopy

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: Depletion of LC3C via siRNA Collapses P. gingivalis (P. g) -Induced Non-Canonical Autophagosomal Integrity. Human primary GECs were treated with LC3C siRNA (100nM) for 48h. P. g was added at MOI 100 to GECs for 6, 12, or 24 h. ( A ) Intracellular P. g survival after LC3C siRNA depletion was determined using a standard antibiotic protection assay. In brief, any extracellular bacteria were killed via 1h gentamicin (300 μg/mL) and metronidazole (200 μg/mL) treatment. cDNAs were synthesized for qPCR using P. g -specific 16S rRNA primers to quantify intracellular levels of live P. g . Data is represented as Mean±SD, where n=3 and p<0.05 was considered as statistically significant via Student two-tailed T-test. *p<.05 **p<.005. ( B ) P. g -specific autophagosomes were also selectively isolated. Autophagosomes were stained for P. g (rabbit anti- P. g ; Alexa 488; green) and reduced GSH (ThiolTracker Violet; blue). Confocal images of P. g -specific autophagosomes at 6 h post-infection (63x) were taken utilizing the Super Resolution Zeiss Airyscan LSM 880.

Article Snippet: Isolated P. gingivalis specific autophagosomes were also fixed in 10% NBF for 1 h, and were stained for 1 h at RT with anti- P. gingivalis ATCC 33277 rabbit antibody (1:1000), followed by incubation in anti-rabbit Alexa Fluor 488 conjugated secondary antibody (Invitrogen, A-11008; 1:1000).

Techniques: Bacteria, Synthesized, Two Tailed Test, Isolation, Staining, Infection

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: Δ ndk-P. gingivalis (P. g) Undergoes Canonical Degradative Autophagosomal Trafficking in Human Primary GECs. Primary GECs were infected with WT P. gingivalis (P. g) versus Δ ndk - P. g at MOI 100 for 3, 12, or 24h. ( A ) TEM analysis used Immunogold labeling for P. g was performed on WT P. g versus Δ ndk - P. g at 3 or 24h post-infection. Images were acquired at 40000x magnification utilizing a Hitachi H-7000 TEM (Hitachi High Technologies America, Inc.) affixed to a Veleta camera with iTEM. ( B ) Separately, GECs were additionally stained for P. g (rabbit anti-P . gingivalis ; Alexa 488; green) and LAMP-1 (mouse anti-LAMP-1; Alexa 568; red) and were imaged. The range of all z-stacks was kept consistent and representative images were selected from the mid-ranged sections. Co-localization analysis of P. g and LAMP-1 was additionally carried out using the Zeiss LSM 880 Confocal Software, determining that the WT P. g had a Pearsons value of .137 while the Δ ndk - P. g had a Pearsons value of .704.

Article Snippet: Isolated P. gingivalis specific autophagosomes were also fixed in 10% NBF for 1 h, and were stained for 1 h at RT with anti- P. gingivalis ATCC 33277 rabbit antibody (1:1000), followed by incubation in anti-rabbit Alexa Fluor 488 conjugated secondary antibody (Invitrogen, A-11008; 1:1000).

Techniques: Infection, Labeling, Staining, Software

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: The Depletion of HSp27 Abrogates the Inhibition of Oxidative Stress and Severely Impacts the Intracellular Survival of P. gingivalis (P. g) Studied in Human Primary Organotypic Cultures of Gingiva. To create the organotypic culture systems, human primary GECs and Fibroblasts Cells (FBCs) were co-cultured together upon a collagen raft. Select rafts were then treated with HSP27 siRNA (100nM) for 48 h. Select rafts were also treated with N-acetyl Cysteine (NAC) (50 uM) for 1 h. P. g was added at MOI 100 to rafts, which were incubated for 24 h. Rafts were then collected and sectioned so that immunofluorescence could be performed. ( A ) Representative images of H&E stained raft culture systems at 20x magnification, which clearly mimic the oral gingival crevice. Scale bar is 50 µm. E: Multilayer Undifferentiated Epithelial Cells, C: Collagen Matrix; F: Fibroblasts. ( B ) Rafts were stained for P. g (rabbit anti- P. g; Alexa 488; green) or HpS27 (mouse anti-HSp27; Alexa 568; red). Rafts were then imaged via confocal microscopy (Leica DM6 CS Stellaris 5 Confocal/Multiphoton System) at 20x and 63x. Scale bar is 50 um for 20x and 20 um for 63x and Zoomed View. The range of z-stacks was kept consistent. HSp27 was once again found to readily co-localize with P.g with a Pearson coefficient of .83 as determined via the Imaris Software. ( Bi ) A Zoomed (4x) version of the 63x magnification was created using the Imaris Software, highlighting the intracellular nature of individual P. g. ( C ) GECs were additionally treated with HSp27 siRNA (100nM) for 48 h. Select GECs were then treated with N-acetyl Cysteine (NAC) (50 uM) for 1 h and/or eATP (3mM) for 30 min. P. g was added at MOI 100 to GECs, which were incubated 6 h. If any extracellular bacteria were present, they were killed by gentamicin (300 μg/mL) and metronidazole (200 μg/mL) treatment for 1 h. cDNAs were synthesized for qPCR using P. g -specific 16S rRNA primers to quantify intracellular level of live P. g . Data is represented as Mean±SD, where n=3 and p<0.05 was considered as statistically significant via One-Way Anova Test. ** p<0.005.

Article Snippet: Isolated P. gingivalis specific autophagosomes were also fixed in 10% NBF for 1 h, and were stained for 1 h at RT with anti- P. gingivalis ATCC 33277 rabbit antibody (1:1000), followed by incubation in anti-rabbit Alexa Fluor 488 conjugated secondary antibody (Invitrogen, A-11008; 1:1000).

Techniques: Inhibition, Cell Culture, Incubation, Immunofluorescence, Staining, Confocal Microscopy, Software, Bacteria, Synthesized

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: Cross-Sectional Human in Situ Sample and Expression Analyses Support High Levels and Increased Co-localization of P. gingivalis (P. g) , HSp27, and LC3C in Periodontitis-Afflicted Oral Tissues. Publicly available mRNA expression data (GEO accession: GSE79705) was obtained from previously collected and examined periodontitis-afflicted and healthy gingival tissues. This microarray expression data was then analyzed via GEO2R and the relative levels of ( A ) HSp27 and ( B ) LC3C were obtained and compared. Data is represented as Mean±SD, where n=12 and p<0.05 was considered as statistically significant via One-Way Anova. *p<0.05. Representative confocal images of gingival biopsy specimens from healthy individuals and periodontitis-afflicted patients were also taken and examined. DAPI staining was utilized to visualize cellular DNA. ( C ) P. g (mouse anti-P . gingivalis ; Alexa 488; green) and LC3C (rabbit anti-LC3C; Alexa 594; red) were detected via dual staining. ( D ) HSp27 (mouse anti-HSp27; Alexa 488; green) and LC3C detection (rabbit anti-LC3C; Alexa 594; red) were also detected. Images were then captured using super resolution confocal laser scanning microscopy (Leica DM6 CS Stellaris 5 Confocal/Multiphoton System) at 10x and 63x magnification with oil immersion. Zoomed (2x) 3D versions of the 63x magnifications were obtained via the Imaris software. The range of z-stacks was kept consistent. SC: Stratum corneum, SL: Stratum lucidum, SG: Stratum granulosum, SB: Stratum basale, LT: Lamina propria. Scale bars = 200µm for 10x and 20 µm for 63x. Quantification of mean fluorescence intensity provided in Supplement. LC3C and HSp27 both were found to exhibit high levels of co-localization with each other and with P. g, as the Pearson coefficient was calculated to be .93 for LC3C and P. g and .85 for LC3C and HSp27 via the Imaris Software at the most severe state of disease.

Article Snippet: Isolated P. gingivalis specific autophagosomes were also fixed in 10% NBF for 1 h, and were stained for 1 h at RT with anti- P. gingivalis ATCC 33277 rabbit antibody (1:1000), followed by incubation in anti-rabbit Alexa Fluor 488 conjugated secondary antibody (Invitrogen, A-11008; 1:1000).

Techniques: In Situ, Expressing, Microarray, Staining, Confocal Laser Scanning Microscopy, Software, Fluorescence

Journal: Archives of Medical Science : AMS

Article Title: Aberrant expression of long non-coding RNAs (lncRNAs) is involved in brain glioma development

doi: 10.5114/aoms.2020.91290

Figure Lengend Snippet: Microarray analysis was applied to detect the lncRNAs and mRNAs in glioma compared to normal peritumoral tissue. A – Differentially expressed lncRNAs were detected in gliomas. A, B – Differentially expressed mRNAs were detected in gliomas. C – Clustering data of lncRNAs in gliomas were analyzed. D – Clustering data of mRNAs in gliomas were analyzed

Article Snippet: The synthesized cDNAs were labeled and hybridized to Arraystar Human lncRNA Microarray V2.0 (Arraystar, Rockville, MD) containing probes for 33,045 lncRNAs and 30,215 mRNAs identified from both publications and authoritative databases, such as RefSeq, UCSC Knowngenes, and Ensembl.

Techniques: Microarray

Journal: Archives of Medical Science : AMS

Article Title: Aberrant expression of long non-coding RNAs (lncRNAs) is involved in brain glioma development

doi: 10.5114/aoms.2020.91290

Figure Lengend Snippet: Summary of data from microarray for three pairs of glioma and adjacent normal tissues

Article Snippet: The synthesized cDNAs were labeled and hybridized to Arraystar Human lncRNA Microarray V2.0 (Arraystar, Rockville, MD) containing probes for 33,045 lncRNAs and 30,215 mRNAs identified from both publications and authoritative databases, such as RefSeq, UCSC Knowngenes, and Ensembl.

Techniques: Microarray, RNA Expression

Journal: Archives of Medical Science : AMS

Article Title: Aberrant expression of long non-coding RNAs (lncRNAs) is involved in brain glioma development

doi: 10.5114/aoms.2020.91290

Figure Lengend Snippet: LncRNA-mRNA co-expression network: nodes with red cycle represent lncRNAs, nodes without cycle represent mRNAs, straight lines represent interactions between genes, purple represents increased expression, and blue represents decreased expression. The size of the node represents the degree; the higher the degree, the more genes interact with the particular node in the network

Article Snippet: The synthesized cDNAs were labeled and hybridized to Arraystar Human lncRNA Microarray V2.0 (Arraystar, Rockville, MD) containing probes for 33,045 lncRNAs and 30,215 mRNAs identified from both publications and authoritative databases, such as RefSeq, UCSC Knowngenes, and Ensembl.

Techniques: Expressing

Journal: Archives of Medical Science : AMS

Article Title: Aberrant expression of long non-coding RNAs (lncRNAs) is involved in brain glioma development

doi: 10.5114/aoms.2020.91290

Figure Lengend Snippet: Degree was used to assess interactions in the lncRNA/mRNA network. This table is a collection of a series of key lncRNA/mRNAs

Article Snippet: The synthesized cDNAs were labeled and hybridized to Arraystar Human lncRNA Microarray V2.0 (Arraystar, Rockville, MD) containing probes for 33,045 lncRNAs and 30,215 mRNAs identified from both publications and authoritative databases, such as RefSeq, UCSC Knowngenes, and Ensembl.

Techniques:

Journal: Archives of Medical Science : AMS

Article Title: Aberrant expression of long non-coding RNAs (lncRNAs) is involved in brain glioma development

doi: 10.5114/aoms.2020.91290

Figure Lengend Snippet: Comparison of microarray data and qPCR results. A – qPCR was used to verify expression of lncRNAs ak125809, ak098473, uc002ehu.1, bc043564, NR_027322, and uc003qmb.2. B – Distribution of lncRNA expression levels were provided. All six lncRNAs of ak125809, ak098473, uc002ehu.1, bc043564, NR_027322, and uc- 003qmb.2 were validated by qPCR analysis in the 40 paired glioma and peritumoral tissues. Each histogram represents the average fold change (T/N) with logarithmic conversion. Error bars are indicative of standard deviation. Distribution of lncRNA expression

Article Snippet: The synthesized cDNAs were labeled and hybridized to Arraystar Human lncRNA Microarray V2.0 (Arraystar, Rockville, MD) containing probes for 33,045 lncRNAs and 30,215 mRNAs identified from both publications and authoritative databases, such as RefSeq, UCSC Knowngenes, and Ensembl.

Techniques: Comparison, Microarray, Expressing, Standard Deviation

Journal: Cell host & microbe

Article Title: Autoreactive T Cells and Chronic Fungal Infection Drive Esophageal Carcinogenesis

doi: 10.1016/j.chom.2017.03.006

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: IKKα antibody (M-110), rabbit , Santa Cruz , Cat# sc-7183.

Techniques: Purification, Virus, Recombinant, Injection, SYBR Green Assay, Plasmid Preparation, Labeling, Extraction, cDNA Synthesis, Cell Isolation, TA Cloning, Microarray, Gene Expression, Software